EXPERIMENTAL

siRNA inhibition of kinase-associated phosphatase (Kap) expression induces M-phase stimulation in NIH/3T3 cells

Inhibarea expresiei fosfatazei asociate kinazei (Kap) prin siRNA induce stimularea fazei M în celulele NIH/3T3

Data publicării: 21 Octombrie 2024
Editorial Group: MEDICHUB MEDIA
10.26416/Diet.3.3.2024.10170

Abstract

The cyclin-dependent kinase inhibitor gene (CDKN3) encodes the kinase-associated phosphatase (KAP) that dephosphorylates the cyclin-dependent kinases CDK1, CDK2 and CDK3. Although we have previously indicated that choline deficiency inhibited cell proliferation and increased Kap expression both in vitro and in vivo, this potential causal mechanistic link was not further explored. Using NIH/3T3 cells, we report that the administration of short interfering RNA (siRNA) targeting Cdkn3 gene expression was followed by a decrease in Kap protein expression and by a subsequent increase in histone H3 phosphorylation (a mitosis marker) at 96 hours of exposure. This study confirms that Kap inhibition was enough in NIH/3T3 cells to stimulate cell proliferation. The hypothesis that choline deficiency may act upon cell proliferation via Cdkn3 remains valid and it deserves further consideration and research. 
 

Keywords
cyclin-dependent kinase 3 inhibitor (Cdkn3)kinase-associated phosphatase (Kap)short interfering RNA (siRNA)cell cyclecell proliferationhistone phosphorylation

Rezumat

Gena inhibitorului kinazei dependente de ciclină (CDKN3) codifică fosfataza asociată kinazei (KAP), care defosforilează kinazele dependente de ciclină CDK1, CDK2 şi CDK3. Administrarea de ARN scurt de interferenţă (siRNA) care vizează expresia genei Cdkn3 a fost urmată de o scădere a expresiei proteinei Kap şi de o creştere ulterioară a fosforilării histonei H3 (un marker de mitoză) la 96 de ore de expunere, folosind celule NIH/3T3. Acest studiu confirmă că, în celulele NIH/3T3, inhibarea proteinei Kap a fost suficientă pentru a stimula proliferarea celulară, ceea ce sugerează că deficienţa de colină poate acţiona asupra proliferării celulare prin intermediul Cdkn3, enunţ care merită o analiză şi cercetare ulterioară.
 
Cuvinte Cheie
inhibitorul kinazei dependente de ciclină (Cdkn3)fosfataza asociată kinazei (Kap)ARN scurt de interferenţă (siRNA)ciclu celularproliferare celularăfosforilare histonă

Introduction

The cyclin-dependent kinase inhibitor gene (CDKN3) encodes the kinase-associated phosphatase (Kap) that dephosphorylates the cyclin-dependent kinases CDK1, CDK2 and CDK3(1-3). Most previous studies have focused on the association of KAP with CDK2 and its subsequent deactivation of this cyclin-dependent kinase by Thr160 dephosphorylation(2,3). This event inhibits CDK2 activity because its phosphorylated form primarily interacts with cyclins A and E(4). The fact that CDK2-mediated phosphorylation of retinoblastoma protein is required for the progression from G1 to S phase of the cell cycle implicated KAP as a regulator of cell cycle progression(5). In yeast cells, over-expression of Kap resulted in slower growth rates(1). However, in mammalian cells, contradictory results were reported. In HeLa cells, Kap associated with both Cdk2 and Cdc2(1,2), and Kap over-expression in G1-synchronized cells resulted in a delay of progression to S-phase(1). However, although Kap was associated with Cdc2, the co-expression of Cdc2 did not rescue the Kap-dependent growth inhibition in these cells(1). In both un-synchronized HeLa and LNCaP (human prostate carcinoma cell line) cells, stable expression of anti-sense KAP diminished, rather than increased, the percentage of cells in S-phase(6).

More recent studies indicated that the role of the CDKN3 gene and its expressed KAP protein in various tumors was heterogenous and had bidirectional effects on cell cycle progression (reviewed in Zhang et al., 2024(7)).

Choline plays a major role in the proliferation of neural progenitors during fetal life(8). The mechanisms involved are diverse, redundant, and we have previously described how choline influences the molecular mechanisms involved in cell proliferation in neural precursor cells(9). Among these changes, we have indicated that choline deficiency reduced cell proliferation and increased Cdkn3 and Kap expression in both in vitro and murine in vivo models(10,11), but without proving that the reduction of cell proliferation was caused by the action of Kap overexpression itself, nor that such modification could, alone, explain the outcomes in cell proliferation. The goal of this study was to test whether the inhibition of Kap synthesis could, solely and without other alterations, stimulate cell proliferation. Here we report that the transient administration of Cdkn3 short interfering RNA (siRNA) to NIH/3T3 cells reduced the expression of Kap protein, and this change alone increased the protein levels of phosphorylated histone H3 (pH3), a specific mitotic marker expressed in late G2 and M phases of the cell-cycle(12).

Materials and method

In order to test the hypothesis, mouse NIH/3T3 cells were used (ATCC, Manassas, VA). NIH/3T3 cells are versatile fibroblast cells isolated from a mouse NIH/Swiss embryo, and extensively used for in vitro molecular biology studies(13). Mouse NIH/3T3 cells were grown in extensively Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, USA), and 10% bovine calf serum (Invitrogen) at 37oC. Thus, 5 x 105 cells were seeded in 10 cm Petri dishes and allowed to reach approximately 30% confluence. A control DNA vector to assess transfection efficiency (green-fluorescent protein, pGFP-H2B) was obtained as a kind gift from Dr. Geoffrey Wahl at the Salk Institute. The cells were transfected using Lipofectamine 2000® (Invitrogen) for the first six hours as follows: with 100 nM of each double-stranded siRNA (siRNA, 200 nM total), 2 µg of a green-fluorescent protein (GFP)-expression vector (GFP/Lipo), with Lipofectamine only (Lipo), or no treatment (CT).

Cells were harvested after 48 and 96 hours, respectively. Four independent samples were used for each condition. Cell lysates were used to assess Kap, pH3 and actin protein levels by polyacrylamide gel electrophoresis (PAGE) and immunoblotting. The cells were harvested, washed in PBS and re-suspended in lysis buffer [1% sodium dodecyl sulfate (SDS), 1 mm sodium ortho-vanadate, 10 mm Tris, pH 7.4]. Protein concentration was determined using the Lowry method(14). Proteins were separated by SDS-PAGE electrophoresis (Bio-Rad, Hercules, CA, USA) and transferred to a nitrocellulose membrane (Amersham)(15).

The following primary antibodies were used: mouse Kap (BD Transduction Laboratories, San Diego, CA, USA), mouse ß-actin (Abcam, Cambridge, MA, USA, ab6276), and rabbit anti-phospho-Histone H3 (Upstate, Lake Placid, NY, USA). To minimize nonspecific binding of the secondary HRP-conjugated antibodies, the Vector M.O.M. Peroxidase Kit (Vector Laboratories, Burlingame, CA, USA, cat. No. PK-2200) was used according to the manufacturer’s protocol.  For the phosphorylated histone H3, we used a secondary goat anti-rabbit HRP-IgG (Santa Cruz Biotechnology) diluted 1:2000 in blocking buffer (Sigma, B-6429). The membranes were briefly exposed to a chemiluminescent agent, Luminol (Santa Cruz Biotechnology). The final images were acquired by exposing the membrane to a Kodak BioMax Film for 30-60 s. The film was scanned, and the integrated optical densities of the bands were measured using the ScionImage software (Scion Corporation, Frederick, MD, USA). The values obtained for Kap and pH3 were normalized to those for ß-actin (used as a marker for protein loading on each sample). Statistical comparisons were performed using the Tukey-Kramer HSD test (JMP 3.2.6, SAS Institute INC, Cary, NC, USA).

The siRNA was designed using the GenBank XM_354809 mRNA sequence [Mus musculus cyclin-dependent kinase inhibitor 3 (Cdkn3)]. Possible siRNA sequences were generated using the online siRNA Target Finder software (Ambion; http://www.ambion.com/techlib/misc/siRNA_finder.html). Two siRNA sequences were used: F2-MCDKN3, target sequence: AAGCCGCCCATTTCAATACAA, position in gene sequence: 87; GC content: 42.9%; sense strand siRNA: GCCGCCCAUUUCAAUACAAtt; antisense strand siRNA: UUGUAUUGAAAUGGGCGGCtt, and F31-MCDKN3, target sequence: AACCGGAAAACCCTGATACAT, position in gene sequence: 480; GC content: 42.9%; sense strand siRNA: CCGGAAAACCCUGAUACAUtt; antisense strand siRNA: AUGUAUCAGGGUUUUCCGGtt. Non-redundant BLAST searches were performed for both target sequences to ensure against non-specific priming (http://www.ncbi.nlm.nih.gov/BLAST/). Double-stranded siRNA sequences were ordered and purchased from Invitrogen.

Results

Figure 1 indicates that the administration of Cdkn3-specific siRNA diminished the Kap protein levels at both 48 (49%) and 96 hours (49%) compared to their respective CT values (p<0.05).  The increased levels of pH3 at 96 hours for the siRNA-treated cells (147%), compared to CT cells, indicates that increased cell proliferation can be achieved by reducing the expression of Kap protein. Statistical comparison between all other groups showed no significant differences for KAP and pH3 protein levels, indicating that changes in pH3 levels were not attributable to the treatment with Lipofectamine or with the GFP-expressing vector. We observed that the decrease in Kap expression preceded the increase in pH3 levels (KAP levels were decreased for the siRNA-treated cells at both 48 and 96 hours, while the increase of the pH3 levels occurred after 96 hours).
 

Figure 1. Cdkn3 siRNA diminishes Kap protein levels and stimulates the expression of phosphorylated histone H3, a cell proliferation marker  The values represent the average integrated optical densities (IOD) of Kap and pH3, normalized to the IOD for actin within each lane (n=4, mean ± standard error). An asterisk denotes a group that is significantly different from all others within its comparison group (Tukey-Kramer HSD test), α=0.05.
Figure 1. Cdkn3 siRNA diminishes Kap protein levels and stimulates the expression of phosphorylated histone H3, a cell proliferation marker The values represent the average integrated optical densities (IOD) of Kap and pH3, normalized to the IOD for actin within each lane (n=4, mean ± standard error). An asterisk denotes a group that is significantly different from all others within its comparison group (Tukey-Kramer HSD test), α=0.05.

Discussion

We reported previously that choline deficiency inhibited cell proliferation in neuroblastoma cells, neural precursor cells, and mouse fetal brains(9-11). This outcome was associated, among other changes, with alterations of the Cdkn3 gene expression, its DNA methylation, and Kap protein levels. However, in those studies, we did not explore the potential mechanistic link between Cdkn3 alterations and decreased cell proliferation, as many other molecular changes were also present.

Here we reported that the reduction of Kap expression, induced by Cdkn3-specific siRNAs, subsequently resulted in increased cell mitosis (pH3 levels), which was subsequent in time to the Kap modifications. These findings support an inhibitory role for Kap in cell-cycle regulation in a NIH/3T3 model. Understanding the function of Kap in choline deficiency adds to the state of knowledge in regard to choline function in brain development.

While in this study we indicated that the inhibition of Kap alone is sufficient to inhibit cell proliferation, several limitations prevent us from assuming that this mechanism could explain the role of choline in cell-cycle progression. As different in vitro models were used, it is difficult to assume that the exact same mechanisms may be at play. Secondly, we have already shown that choline deficiency induced multiple gene expression changes related to cell-cycle progression(9).

As choline deficiency induced a multitude of gene expression changes in neuronal progenitor cells, related to cell proliferation, neuronal and glial differentiation, apoptosis, calcium binding, methyl group metabolism and other mechanisms(9), it is not clear whether the model studied in this experiment would apply “as is” in the development of neuronal progenitor cells in vivo. Therefore, more mechanistic studies are needed to unravel the roles that choline has in regulating cell proliferation in various cell types and system and to establish the relevance of such alterations to brain development.

Conclusions

In NIH/3T3 cells, the inhibition of Kap synthesis induced, alone and by itself, increased cell proliferation. These findings support the hypothesis that choline availability may influence cell proliferation through alterations of the CDKN3-related pathways.  

 

Acknowledgment. This work was supported, in part, by internal funds granted to the author by the UNC at Chapel Hill. Support for this work was also provided by grants from the NIH to the UNC Clinical Nutrition Research Unit (DK56350).  

 

 

Autori pentru corespondenţă: Mihai D. Niculescu E-mail: mihai.niculescu@gmail.com

CONFLICT OF INTEREST: none declared.

FINANCIAL SUPPORT: none declared.

This work is permanently accessible online free of charge and published under the CC-BY.

A grey and black sign with a person in a circle

Description automatically generated
A grey and black sign with a person in a circle Description automatically generated

Bibliografie


  1. Gyuris J, Golemis E, Chertkov H, Brent R. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell. 1993;75(4):791-803. 

  2. Hannon GJ, Casso D, Beach D. KAP: a dual specificity phosphatase that interacts with cyclin-dependent kinases. Proc Natl Acad Sci USA. 1994;91(5):1731-5. 

  3. Poon RY, Hunter T. Dephosphorylation of Cdk2 Thr160 by the cyclin-dependent kinase-interacting phosphatase KAP in the absence of cyclin. Science. 1995;270(5233):90-3. 

  4. Johnson L, De Moliner E, Brown N, et al. Structural studies with inhibitors of the cell cycle regulatory kinase cyclin-dependent protein kinase 2. Pharmacol Ther. 2002;93(2-3):113-124. 

  5. Davies T, Pratt D, Endicott J, Johnson L, Noble M. Structure-based design of cyclin-dependent kinase inhibitors. Pharmacol Ther. 2002;93(2-3):125-133. 

  6. Lee SW, Reimer CL, Fang L, Iruela-Arispe ML, Aaronson SA. Overexpression of kinase-associated phosphatase (KAP) in breast and prostate cancer and inhibition of the transformed phenotype by antisense KAP expression. Molecular and Cellular Biology. 2000;20(5):1723-32. 

  7. Zhang C, Shen Q, Gao M, Li J, Pang B. The role of Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in promoting human tumors: Literature review and pan-cancer analysis. Review. Heliyon. 2024;10(4):e26061. 

  8. Zeisel SH. Choline. A nutrient that is involved in the regulation of cell proliferation, cell death, and cell transformation. Adv Exp Med Biol. 1996;399:131-41. 

  9. Niculescu MD, Craciunescu CN, Zeisel SH. Gene expression profiling of choline-deprived neural precursor cells isolated from mouse brain. Brain Res Mol Brain Res. 2005;134(2):309-22. 

  10. Niculescu MD, Craciunescu CN, Zeisel SH. Dietary choline deficiency alters global and gene-specific DNA methylation in the developing hippocampus of mouse fetal brains. Faseb J. 2006;20(1):43-9. 

  11. Niculescu MD, Yamamuro Y, Zeisel SH. Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin-dependent kinase inhibitor 3 gene. J Neurochem. 2004;89(5):1252-9. 

  12. Hans F, Dimitrov S. Histone H3 phosphorylation and cell division. Oncogene. 2001;20(24):3021-7. 

  13. Todaro GJ, Green H. Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. The Journal of Cell Biology. 1963;17(2):299-313. 

  14. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193(1):265-75. 

  15. Spector D, Godlman R, Leinwand L. Cell culture and biochemical analysis of cells. In: Cells: A Laboratory Manual. Cold Spring Harbor Laboratory Press; 1997;1:73.1-73.12.

Articole din ediția curentă

REVIEW

Alimente recomandate în prevenirea cancerului colorectal

Ioana-Ştefania Şerban
Cancerul colorectal este al treilea cel mai frecvent cancer diagnosticat atât la bărbaţi, cât şi la femei. ...
CASE REPORT

Efectul dietei, al antrenamentului fizic asistat şi al remodelării corporale asupra pierderii în greutate – studiu de caz

Raluca Maior, Florina Daniela Ruţă
Restricţia aportului energetic şi procentajul echilibrat al macronutrienţilor din dietă rămân strategia de bază în managementul obezităţii, iar activitatea fizică oferă beneficii suplimentare în dimin...
REVIEW

Managementul obezităţii genetice cu dieta mediteraneeană

Dalma Máté
Supraponderalitatea este unul dintre cele mai semnificative riscuri ale zilelor noastre. Bolile cronice asociate cu supraponderalitatea reprezintă o parte semnificativă a numărului de boli şi decese....
Articole din edițiile anterioare